SubtiBank SubtiBank
codY [2019-02-19 17:59:58]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

codY [2019-02-19 17:59:58]

regulation of a large regulon (more than 100 genes and operons) in response to branched-chain amino acid limitation
locus
BSU16170
pI
4.75
mw
28.86 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
function
regulation of a large regulon in response to branched-chain amino acid limitation
product
transcriptional pleiotropic repressor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    1,690,119 1,690,898

    Phenotypes of a mutant

  • no swarming motility on B medium. [Pubmed|19202088]
  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • inactivation of ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]'' suppresses the requirement of a ''[gene|CEE73284EFC0DBE8870CE0B474922DED79475A57|relA] [gene|1107A963C253FBEE8716507BD0EC0E7CD5642B12|sasA] [gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]'' triple mutant for branched chain amino acids, methionine and threonine [Pubmed|24163341]
  • The protein

    Protein family

  • codY family (according to Swiss-Prot)
  • [SW|Domains]

  • contains a GAF domain (ligand binding domain)
  • Modification

  • phosphorylation on Ser-215 [Pubmed|17218307]
  • Effectors of protein activity

  • GTP and branched chained amino acids (BCAA) increase the affinity of CodY for its DNA target sequences [Pubmed|11331605,15228537,21856856]
  • Structure

  • [PDB|5LOO] (unliganded full-length protein) [Pubmed|28011634]
  • [PDB|2B0L] (C-terminal DNA-binding domain), [PDB|2GX5] (N-terminal Gaf domain)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000045 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|B6062575849EA65BB7B44A9723676885799E2759|trmFO]-[gene|89746E312F20C81BE3CFDFCE7D99B01C375C198B|codV]-[gene|F6B748621B312E0B5A0A0782F3944C3E8112D7A8|clpQ]-[gene|2A5A080273CB7698DFABB147F4143E90BBCA3B01|clpY]-[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7783641], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|11331605], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|11331605]
  • additional information

  • the intracellular concentration of CodY is about 2.5 myM (according to [PubMed|20408793])
  • view in new tab

    Biological materials

    Mutant

  • GP566 available in [SW|Jörg Stülke]'s lab
  • GP2473 (''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • a ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::erm'' mutant is available in [SW|Linc Sonenshein]'s lab
  • a ''[gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::spc'' (BB1043) mutant is available in [SW|Linc Sonenshein]'s, [SW|Fabian Commichau]'s and [SW|Jrg Stlke]'s labs
  • BKE16170 ([gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAATAATCCTCCTA, downstream forward: _UP4_TAATCACAAAAAGAACCCTT
  • BKK16170 ([gene|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAATAATCCTCCTA, downstream forward: _UP4_TAATCACAAAAAGAACCCTT
  • Expression vectors

  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP245, available in [SW|Jrg Stlke]'s lab
  • pBP616 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Fabian Commichau]'s lab)
  • pBP618 (C-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP382]) (available in [SW|Fabian Commichau]'s lab)
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Fabian Commichau]'s lab
  • labs

  • [SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
  • [SW|Tony Wilkinson], York University, U.K. [http://www.york.ac.uk/depts/chem/staff/ajw.html Homepage]
  • [SW|Oscar Kuipers], University of Groningen, The Netherlands, [http://molgen.biol.rug.nl/molgen/index.php Homepage]
  • References

    Reviews

  • 15802253,17982469,20408793,24462007
  • The [SW|CodY regulon]

  • 18083814,12618455,23569278,24843172
  • Original Publications

  • 19542274,17493123,18641142,19202088,16995897,17993518,9287005,11331605,17218307,19500589,12591885,19202088,11331605,15228537,8793880,26170408,15937175,15916605,15916606,11331605,15228537,19749041,7783641,20935095,21097623,21699902,21764931,22981860,22512862,21856856,23911932,24296669,24163341,25157083,25645558,24682323,25666135,25966844,26220295,26473603,26728191,27596595,28011634,28371347,30096425